NOTE: This analysis requires at least 10Gb of RAM to run. It uses large files not included in the repository and many steps can take a few minutes to run.
input_folder <- "raw_input" # Where all the large input files are. Ignored by git.
output_folder <- "results" # Where plots will be saved
output_format <- "pdf" # The file format of saved plots
pub_fig_folder <- "publication"
revision_n <- 1
result_path <- function(name) {
file.path(output_folder, paste0(name, ".", output_format))
}
save_publication_fig <- function(name, figure_number) {
file.path(result_path(name), paste0("revision_", revision_n), paste0("figure_", figure_number, "--", name, ".", output_format))
}
These settings are shared between the RDP, SILVA, and Greengenes analyses, since the results of those three analyeses are combined in one plot later. This ensures that all of the graphs use the same color and size scales, instead of optimizing them for each data set, as would be done automatically otherwise.
size_range <- c(0.0004, 0.015) # The size range of nodes
label_size_range <- c(0.0015, 0.05) # The size range of labels
all_size_interval <- c(1, 3000000) # The range of read counts to display in the whole database plots
pcr_size_interval <- c(1, 25000) # The range of read counts to display in the PCR plots
label_max <- 50 # The maximum number of labels to show on each graph
max_taxonomy_depth <- 4 # The maximum number of taxonomic ranks to show
min_seq_count <- NULL # The minimum number of sequeces need to show a taxon.
just_bacteria <- TRUE # If TRUE, only show bacterial taxa
max_mismatch <- 10 # Percentage mismatch tolerated in pcr
pcr_success_cutoff <- 0.90 # Any taxon with a greater proportion of PCR sucess will be excluded from the PCR plots
min_seq_length <- 1200 # Use to encourage full length sequences
forward_primer = c("515F" = "GTGYCAGCMGCCGCGGTAA")
reverse_primer = c("806R" = "GGACTACNVGGGTWTCTAAT")
pcr_success_color_scale = c(viridis::plasma(10)[4:9], "lightgrey")
The greengenes database stores sequences in one file and taxonomy information in another and the order of the two files differ making parseing more difficult than the other databases. Since taxonomy inforamtion is needed for creating the taxmap data structure, we will parse it first and add the sequence information on after. The input files are not included in this repository because they are large, but you can download them from the Greengenes website here:
http://greengenes.lbl.gov/Download/
gg_taxonomy_path <- file.path(input_folder, "gg_13_5_taxonomy.txt")
gg_taxonomy <- readLines(gg_taxonomy_path)
print(gg_taxonomy[1:5])
## [1] "228054\tk__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synechococcales; f__Synechococcaceae; g__Synechococcus; s__"
## [2] "844608\tk__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synechococcales; f__Synechococcaceae; g__Synechococcus; s__"
## [3] "178780\tk__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synechococcales; f__Synechococcaceae; g__Synechococcus; s__"
## [4] "198479\tk__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synechococcales; f__Synechococcaceae; g__Synechococcus; s__"
## [5] "187280\tk__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synechococcales; f__Synechococcaceae; g__Synechococcus; s__"
Note that there are some ranks with no names. These will be removed after parsing the file since they provide no information and an uniform-length taxonomy is not needed.
library(metacoder)
# Parse taxonomy file
greengenes <- extract_taxonomy(input = gg_taxonomy, key = c(id = "obs_info", "class"), regex = "^([0-9]+)\t(.*)$", class_sep = "; ", class_regex = "^([a-z]{1})__(.*)$", class_key = c(rank = "taxon_info", "name"))
# Remove data for ranks with no information
greengenes <- filter_taxa(greengenes, name != "")
print(greengenes)
## `taxmap` object with data for 3093 taxa and 1262986 observations:
##
## ------------------------------- taxa -------------------------------
## 1, 2, 4, 5, 6, 7 ... 7339, 7340, 7341, 7342, 7355, 7363, 7364
##
## ---------------------------- taxon_data ----------------------------
## # A tibble: 3,093 × 4
## taxon_ids supertaxon_ids rank name
## <chr> <chr> <chr> <chr>
## 1 1 <NA> k Archaea
## 2 2 <NA> k Bacteria
## 3 4 1 p Crenarchaeota
## 4 5 1 p Euryarchaeota
## 5 6 1 p Nanoarchaeota
## 6 7 1 p [Parvarchaeota]
## 7 14 4 c AAG
## # ... with 3,086 more rows
##
## ----------------------------- obs_data -----------------------------
## # A tibble: 1,262,986 × 2
## obs_taxon_ids id
## <chr> <dbl>
## 1 2971 228054
## 2 2971 844608
## 3 2971 178780
## 4 2971 198479
## 5 2971 187280
## 6 2971 179180
## 7 2971 175058
## # ... with 1.263e+06 more rows
##
## --------------------------- taxon_funcs ---------------------------
## n_obs, n_obs_1, n_supertaxa, n_subtaxa, n_subtaxa_1, hierarchies
Next we will parse the sequence file so we can add it to the obs_data table of the greengenes object.
gg_sequence_path <- file.path(input_folder, "gg_13_5.fasta")
substr(readLines(gg_sequence_path, n = 10), 1, 100)
## [1] ">1111886"
## [2] "AACGAACGCTGGCGGCATGCCTAACACATGCAAGTCGAACGAGACCTTCGGGTCTAGTGGCGCACGGGTGCGTAACGCGTGGGAATCTGCCCTTGGGTAC"
## [3] ">1111885"
## [4] "AGAGTTTGATCCTGGCTCAGAATGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGTACGAGAAATCCCGAGCTTGCTTGGGAAAGTAAAGTGGCGCAC"
## [5] ">1111883"
## [6] "GCTGGCGGCGTGCCTAACACATGTAAGTCGAACGGGACTGGGGGCAACTCCAGTTCAGTGGCAGACGGGTGCGTAACACGTGAGCAACTTGTCCGACGGC"
## [7] ">1111882"
## [8] "AGAGTTTGATCATGGCTCAGGATGAACGCTAGCGGCAGGCCTAACACATGCAAGTCGAGGGGTAGAGGCTTTCGGGCCTTGAGACCGGCGCACGGGTGCG"
## [9] ">1111879"
## [10] "CCTAATGCATGCAAGTCGAACGCAGCAGGCGTGCCTGGCTGCGTGGCGAACGGCTGACGAACACGTGGGTGACCTGCCCCGGAGTGGGGGATACCCCGTC"
This can be easily parsed using the R package seqinr:
gg_sequences <- seqinr::read.fasta(gg_sequence_path, as.string = TRUE)
We will need to use the Greengenes ID to match up which sequence goes with which row since they are in different orders.
greengenes <- mutate_obs(greengenes, sequence = unlist(gg_sequences)[as.character(id)])
Next I will subset the taxa in the dataset (depending on parameter settings). This can help make the graphs less cluttered and make it easier to compare databases.
if (! is.null(min_seq_count)) {
greengenes <- filter_taxa(greengenes, n_obs >= min_seq_count)
}
if (just_bacteria) {
greengenes <- filter_taxa(greengenes, name == "Bacteria", subtaxa = TRUE)
}
if (! is.null(max_taxonomy_depth)) {
greengenes <- filter_taxa(greengenes, n_supertaxa <= max_taxonomy_depth)
}
print(greengenes)
## `taxmap` object with data for 1138 taxa and 1242330 observations:
##
## ------------------------------- taxa -------------------------------
## 2, 553, 644, 645, 646 ... 7335, 7329, 7355, 637, 7363, 7364
##
## ---------------------------- taxon_data ----------------------------
## # A tibble: 1,138 × 4
## taxon_ids supertaxon_ids rank name
## <chr> <chr> <chr> <chr>
## 1 2 <NA> k Bacteria
## 2 553 2 p AC1
## 3 644 553 c B04R032
## 4 645 553 c HDBW-WB69
## 5 646 553 c SHA-114
## 6 647 553 c TA06
## 7 554 2 p Acidobacteria
## # ... with 1,131 more rows
##
## ----------------------------- obs_data -----------------------------
## # A tibble: 1,242,330 × 3
## obs_taxon_ids id
## <chr> <dbl>
## 1 2957 228054
## 2 2957 844608
## 3 2957 178780
## 4 2957 198479
## 5 2957 187280
## 6 2957 179180
## 7 2957 175058
## # ... with 1.242e+06 more rows, and 1 more variables: sequence <chr>
##
## --------------------------- taxon_funcs ---------------------------
## n_obs, n_obs_1, n_supertaxa, n_subtaxa, n_subtaxa_1, hierarchies
These are not bacterial and will bias the in silico PCR results. Note that the invert option makes it so taxa are included that did not pass the filter. This is different than simply using name != "Chloroplast", subtaxa = TRUE since the effects of invert are applied after those of subtaxa.
greengenes <- filter_taxa(greengenes, name == "Chloroplast", subtaxa = TRUE, invert = TRUE)
print(greengenes)
## `taxmap` object with data for 1121 taxa and 1242330 observations:
##
## ------------------------------- taxa -------------------------------
## 2, 553, 644, 645, 646 ... 7335, 7329, 7355, 637, 7363, 7364
##
## ---------------------------- taxon_data ----------------------------
## # A tibble: 1,121 × 4
## taxon_ids supertaxon_ids rank name
## <chr> <chr> <chr> <chr>
## 1 2 <NA> k Bacteria
## 2 553 2 p AC1
## 3 644 553 c B04R032
## 4 645 553 c HDBW-WB69
## 5 646 553 c SHA-114
## 6 647 553 c TA06
## 7 554 2 p Acidobacteria
## # ... with 1,114 more rows
##
## ----------------------------- obs_data -----------------------------
## # A tibble: 1,242,330 × 3
## obs_taxon_ids id
## <chr> <dbl>
## 1 2957 228054
## 2 2957 844608
## 3 2957 178780
## 4 2957 198479
## 5 2957 187280
## 6 2957 179180
## 7 2957 175058
## # ... with 1.242e+06 more rows, and 1 more variables: sequence <chr>
##
## --------------------------- taxon_funcs ---------------------------
## n_obs, n_obs_1, n_supertaxa, n_subtaxa, n_subtaxa_1, hierarchies
Although graphing everything can be a bit overwhelming (1121 taxa), it gives an intuitive feel for the complexity of the database:
greengenes_plot_all <- heat_tree(greengenes,
node_size = n_obs,
node_color = n_obs,
node_size_range = size_range * 2,
edge_size_range = size_range,
node_size_interval = all_size_interval,
edge_size_interval = all_size_interval,
node_color_interval = all_size_interval,
edge_color_interval = all_size_interval,
node_label = name,
node_label_max = label_max,
node_label_size_range = label_size_range,
node_color_axis_label = "Sequence count",
make_legend = TRUE,
output_file = result_path("greengenes--all"))
print(greengenes_plot_all)
Before doing the digital PCR, I will filter for only full length sequences, since shorter sequences might not have a primer binding site and the digital PCR would fail, not because of an inability of a real primer to bind to real DNA, but because of missing sequence information in the database. Ideally, this kind of filtering for full length sequences would involve something like a multiple sequences alignment so we don’t remove sequences that are actually full length, but just happen to be shorter than the cutoff of 1200 naturally. However, this method is easy and should work OK.
if (! is.null(min_seq_length)) {
greengenes <- filter_obs(greengenes, nchar(sequence) >= min_seq_length, unobserved = FALSE)
}
print(greengenes)
## `taxmap` object with data for 1121 taxa and 1242309 observations:
##
## ------------------------------- taxa -------------------------------
## 2, 553, 644, 645, 646 ... 7335, 7329, 7355, 637, 7363, 7364
##
## ---------------------------- taxon_data ----------------------------
## # A tibble: 1,121 × 4
## taxon_ids supertaxon_ids rank name
## <chr> <chr> <chr> <chr>
## 1 2 <NA> k Bacteria
## 2 553 2 p AC1
## 3 644 553 c B04R032
## 4 645 553 c HDBW-WB69
## 5 646 553 c SHA-114
## 6 647 553 c TA06
## 7 554 2 p Acidobacteria
## # ... with 1,114 more rows
##
## ----------------------------- obs_data -----------------------------
## # A tibble: 1,242,309 × 3
## obs_taxon_ids id
## <chr> <dbl>
## 1 2957 228054
## 2 2957 844608
## 3 2957 178780
## 4 2957 198479
## 5 2957 187280
## 6 2957 179180
## 7 2957 175058
## # ... with 1.242e+06 more rows, and 1 more variables: sequence <chr>
##
## --------------------------- taxon_funcs ---------------------------
## n_obs, n_obs_1, n_supertaxa, n_subtaxa, n_subtaxa_1, hierarchies
Next I will conduct digital PCR with a new set of universal 16S primers (Walters et al. 2016), allowing for a maximum mismatch of 10%.
greengenes_pcr <- primersearch(greengenes,
forward = forward_primer,
reverse = reverse_primer,
mismatch = max_mismatch)
Now the object greengenes_pcr has all the information that greengenes has plus the results of the digital PCR. Lets plot the whole database again, but coloring based on digital PCR success.
greengenes_plot_pcr_all <- heat_tree(greengenes_pcr,
node_size = n_obs,
node_label = name,
node_color = prop_amplified,
node_color_range = pcr_success_color_scale,
node_color_trans = "linear",
node_label_max = label_max,
node_label_size_range = label_size_range,
edge_color_interval = c(0, 1),
node_color_interval = c(0, 1),
node_color_axis_label = "Proportion PCR success",
node_size_axis_label = "Sequence count",
output_file = result_path("greengenes--pcr_all"))
print(greengenes_plot_pcr_all)
Since these are universal bacterial primers, we would expect most of the database to amplify. The plot shows this and very few sequences were not amplified. If we wanted to look at only those sequences that did not amplify, we could filter taxa by PCR success and plot what remains. I am including the supertaxa of those taxa that did not amplify since excluding them would split the tree into a cloud of fragments lacking taxonomic context.
greengenes_plot_pcr_fail <- greengenes_pcr %>%
filter_taxa(prop_amplified < pcr_success_cutoff, supertaxa = TRUE) %>%
heat_tree(node_size = n_obs - count_amplified,
node_label = name,
node_color = prop_amplified,
node_size_range = size_range * 2,
edge_size_range = size_range,
node_size_interval = pcr_size_interval,
edge_size_interval = pcr_size_interval,
node_color_range = pcr_success_color_scale,
node_color_trans = "linear",
node_color_interval = c(0, 1),
edge_color_interval = c(0, 1),
node_label_size_range = label_size_range,
node_label_max = label_max,
node_color_axis_label = "Proportion PCR success",
node_size_axis_label = "Sequences not amplified",
make_legend = TRUE,
output_file = result_path("greengenes--pcr_fail"))
print(greengenes_plot_pcr_fail)
Some results from this file will be combined with others from similar analyses to make a composite figure. Below, the needed objects are saved so that they can be loaded by another Rmd file.
save(file = file.path(output_folder, "greengenes_data.RData"),
greengenes_plot_all, greengenes_plot_pcr_fail)
sessionInfo()
## R version 3.3.1 (2016-06-21)
## Platform: x86_64-pc-linux-gnu (64-bit)
## Running under: Ubuntu 14.04.2 LTS
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## attached base packages:
## [1] grid stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] metacoder_0.1.2 knitcitations_1.0.7 knitr_1.14
##
## loaded via a namespace (and not attached):
## [1] Rcpp_0.12.9 formatR_1.4 plyr_1.8.4 bitops_1.0-6
## [5] viridis_0.3.4 tools_3.3.1 digest_0.6.12 lubridate_1.6.0
## [9] evaluate_0.10 tibble_1.2 gtable_0.2.0 bibtex_0.4.0
## [13] igraph_1.0.1 DBI_0.5-1 yaml_2.1.13 gridExtra_2.2.1
## [17] RefManageR_0.13.1 httr_1.2.1 stringr_1.1.0 dplyr_0.5.0
## [21] rprojroot_1.2 ade4_1.7-4 R6_2.2.0 XML_3.98-1.4
## [25] rmarkdown_1.3 RJSONIO_1.3-0 reshape2_1.4.2 ggplot2_2.2.1
## [29] seqinr_3.3-3 magrittr_1.5 backports_1.0.5 scales_0.4.1
## [33] htmltools_0.3.5 assertthat_0.1 colorspace_1.2-7 labeling_0.3
## [37] stringi_1.1.2 RCurl_1.95-4.8 lazyeval_0.2.0 munsell_0.4.3
Walters, William, Embriette R Hyde, Donna Berg-Lyons, Gail Ackermann, Greg Humphrey, Alma Parada, Jack A Gilbert, et al. 2016. “Improved Bacterial 16S RRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys.” MSystems 1 (1). American Society for Microbiology Journals: e00009–15.
Comments